DSpace About DSpace Software
 

DSpace Biblioteca Universidad de Talca (v1.5.2) >
Facultad de Ciencias de la Salud >
Memoria de pregrado Tecnología Médica >

Please use this identifier to cite or link to this item: http://dspace.utalca.cl/handle/1950/2114

Title: Polimorfismo Gln223Arg del receptor de la leptina en mujeres con SOP, obesas y no obesas de la ciudad de Talca
Authors: Vergara Arcos, Alejandra Fabiola
Moore Carrasco, Rodrigo (Prof. Guia)
Issue Date: 2005
Publisher: Universidad de Talca (Chile). Escuela de Tecnologia Medica
Abstract: El síndrome de ovario poliquístico (SOP) es una endocrinopatía de alta prevalencia en la mujer, observándose en el 5-10% de las mujeres en edad reproductiva. Su patogénesis sigue, hasta ahora, siendo confusa, por la heterogeneidad de sus interacciones fisiopatológicas y por la abundancia de su expresión clínica. Dentro de este intrincado laberinto, es apasionante la relación con la insulina y otras hormonas que participan en el metabolismo energético, lo que no solo obliga a concretar el diagnostico de este síndrome, sino también al uso de medidas preventivas dirigidas a prevenir (retardar) los desordenes metabólicos con el relacionado. La causa de hiperinsulinemia en las mujeres con SOP puede ser multifactorial, bien por una hipersecreción primaria del páncreas endocrino, bien por la mutación del gen que codifica para el receptor de insulina, o bien por la existencia de anticuerpos frente a este receptor, independientemente de ellos, la obesidad, que frecuentemente acompaña al SOP, incrementa por otros mecanismos la insulino resistencia y la hiperinsulinemia. La insulina posee una acción directa sobre el ovario, a través de receptores propios, estimulando la producción de andrógenos, de forma secundaria a una alteración de la secreción de gonadotropinas, o bien como consecuencia de la respuesta ovárica de otros mediadores como la leptina La leptina, informa al cerebro de las reservas grasas para así regular la ingesta calórico, el gasto energético y la termogénesis (la exposición al frío tiene como resultado un notable descenso de la síntesis de leptina en el tejido adiposo, aumento del gasto energético y movilización de los ácidos grasos. Señal de saciedad, las concentraciones elevadas de leptina pueden indicar que las reservas de energía son suficientes, mientras que las concentraciones bajas informan al cerebro acerca de un suministro de energía limitado. La leptina y el receptor de la leptina, han sido definidos como un mediador mas en la regulación biológica de la ingestión de alimentos y de la hemostasia energética. Sin embrago, el rol exacto de la leptina y de su receptor en la maduración sexual no esta del todo claro, sin embargo, deficiencias y/o polimorfismos de estas dos moléculas, estan asociados a un retraso en el normal desarrollo puberal. La disfunción genética del receptor de la leptina ha sido asociada en tres modelos de obesidad y el gen del LEPR aparece como posible candidato para el modelo de obesidad humana, en asociación con la alta expresión de mRNA y altos niveles de leptina sérica. Varios polimorfismos en común y raras variantes genéticas de la isoforma larga del LEPR han sido reportados, y la potencial asociación de esos polimorfismos con la obesidad han sido evaluadas en distintas poblaciones. Aunque a lo menos 2 estudios han encontrado una relación significativa entre la composición corporal y las variables y polimorfismos del gene del LEPR, cinco estudios previos no encontraron en sus estudios una correlación significante. Estos conflictivos resultados pueden ser atribuidos a los variados modelos genéticos que poseen los distintos tipos de poblaciones. Material y método Las muestras de sangre serán obtenidas de mujeres con síndrome de ovario poliquístico obesas y no obesas, que conseguiremos en dos policlínicos de especialidades de la Ciudad de Talca. Se obtuvo sangre total de 23 mujeres con SOP de la ciudad de Talca, se le extyrajo ADN y se procedió a realizar un RFLP para amplificar un segmento especifico (tabla N° 1 ) del receptor de la leptina. En este trabajo se pesquisará el polimorfismo Gln223Arg del exon 6 del receptor de la leptina. Exon 6: 123 aminoácidos. Mutación en el codon 223; sustitución en el nucleótido 668 de una adenina por una guanina. La técnica de PCR y la digestión enzimático correspondientes para cada polimorfismo se realizara según las técnicas descritas en dos investigaciones previas. Tabla N°1. Polimorfismos en estudio.Exon Sustitucion Primers forward Primers reverse enzima Producto Exon 6 A668G Gln223Arg aactcaacgacactctcctt gtcacctctaatgtcagttca MspI 58pb 22 pb Las muestras fueron amplificadas utilizando 2 ug de ADN, 10 pmoles de cada primers, 1.5 mM de MgCl2, 250 mM de dNTPs, 0.4 U de Taq polimerara, 1X de Buffer PCR, y llevadas a un volumen final de 50ul. Los ciclos de amplificación, fueron: 2 min a 94ªC, 1min a 94ªC, 45 seg a 50ªC y 30 a 72 ªC y una extensión final de 7 min a 72 ªC y conservadas a -4ªC . La digestión se realizo con 5U de enzima y 1X de buffer y dejadas toda la noche a 37ªC. Resultados Las muestras fueron amplificadas y luego digeridas siguiendo con el protocolo establecido. Ninguna de las muestras que se procesaron resultó positiva para la mutación, quedando solo un fragmento de 79 pb que es el resultado de la amplificación, ya que la enzima solo cortaría si la alteración nucleotídica se encuentra presente. Discusión y conclusión • A pesar que el protocolo de la técnica fue estándar para todas las muestras, ocurrió que ciertas muestras no amplificaron, esto podemos explicarlos y responsabilizar a la materia prima: el ADN, que por motivos de numerosas manipulaciones, terminópor ser degradado. Debemos recordar que la técnica de extracción es manual y consta de numerosos pasos, los que aumentan las fuentes de error. Por lo tanto, el que no todas las muestras fueran amplificadas se debió a un problema de la muestra y no a un inconveniente con el protocolo de PCR. • Las muestras que fueron amplificadas, fueron luego sometidas a digestión enzimática. En nuestro estudio, ninguna muestra fue digerida, lo que significa que la sustitución nucleotídica no estaba presente. Esta conclusión, esta dada por la validación de la enzima, pues se comprobó que la enzima estaba activa, para ello se utilizó un vector plasmidial que contenía varios sitios de corte para la enzima. Con el vector se realizó el mismo protocolo de digestión, que con las muestras. • No podemos concluir en este estudio que el polimorfismo Gln223Arg del exon 6 de la región extracelular del LEPR, no está presente en mujeres con síndrome de ovario poliquistico obesas y no obesas de la ciudad de Talca. Esta conclusión sería apresurada y no valida por varios aspectos. El primero y mas importante de ellos es el tamaño de la muestra, si bien es cierto, el “n” estaba de acuerdo con el padecimiento del SOP, no se tiene antecedentes sobre la frecuencia de la portacion de la mutación en Chile, por lo tanto para realizarlo debemos contar con un “n” mas grande.
Description: 83 p.
URI: http://dspace.utalca.cl/handle/1950/2114
Appears in Collections:Memoria de pregrado Tecnología Médica

Files in This Item:

File Description SizeFormat
vergara_arcos.pdfResumen27.12 kBAdobe PDFView/Open
vergara_arcos.htmlLink a Texto Completo 2.54 kBHTMLView/Open

Items in DSpace are protected by copyright, with all rights reserved, unless otherwise indicated.

 

Valid XHTML 1.0! DSpace Software Copyright © 2002-2009  The DSpace Foundation - Feedback